Борьба с болезнями и вредителями

Вы можете заказать журналы в редакции:

по тел. 8-495-797-89-29;

е-mail: Этот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра.;


или оставить ЗАЯВКУ НА САЙТЕ

Подписаться на журнал «Пчеловодство»

на почте

по каталогу «Газеты. Журналы»

 агентства «РОСПЕЧАТЬ»

ИНДЕКС — 70739 (полгода), 71729 (на год).

Подписаться для стран
дальнего и ближнего зарубежья
можно на сайте



Воскресенье июня 25, 2017
Russian English French German Italian

УДК 619:616.995.733.4:636

аннотацияПробы (ульевые пчелы) собраны в Монголии в районах наиболее развитого пчеловодства: в западной части страны (Увс аймаг, Тэс сум) — первая группа (первый регион), в северной части (Сэлэнгэ аймаг, Шаамар, Хушаат, Баянгол сум, Дархан-Уул аймаг Шарын гол, Орхон сум) — вторая группа (второй регион), в центральной части страны (Төв аймаг, Батсүмбэр сум, Улаанбаатар, Тэрэлж, Хэнтий аймаг Багануур) — третья группа (третий регион). 

Идентификация вируса была проведена в течение 2013–2014 гг. в лаборатории Института здоровья пчел Университета Берна. В исследованиях использовали 138 проб из 150 семей указанных трех регионов Монголии. Пробы хранили в морозильнике при –80°С. До проведения молекулярной диагностики на наличие в биопробе филаментовируса определяли зараженность пчел клещами варроа по методике, описанной в Bee Book (2013). ДНК из биологических тканей пчел выделяли с использованием набора NucleoSpin® DNA Insect (Machery Nagel, Франция) согласно инструкции производителя. ПЦР проводили с праймерами CAGAGAATTCGGTTTTTGTGAGTG (F) и CATGGTGGCCAAGTCTTGCT (R) [5] в конечном объеме 25 мкл. При процедуре соблюдали следующие условия: начальная денатурация при 94°C в течение 2 минут, за которой следовали 35 циклов: денатурация при 94°C в течение 30 секунд — отжиг — 56°C в течение 30 секунд — полимеризация — 72°C в течение 30 секунд; заключительная полимеризация — 72°C в течение 2 минут. Для визуализации продуктов амплификации проводили электрофорез в 1,5%-ном агарозном геле.

Таким образом, при анализе полученных результатов установлено, что степень поражения семей пчел филаментовирозом находится в зависимости от локализации пасек. Логично, что пасеки, находящиеся рядом друг с другом, оказались заражены в большей степени. Возможно, это свидетельствует о том, что пчеловоды близко находящихся пасек «обмениваются» вирусами, когда подсиливают свои пчелиные семьи рамками с кормовыми запасами и с расплодом с соседней пасеки или приобретают там целые семьи. Эффекты такого «подсиливания», по всей видимости, проявляются только в границах одной пасеки или одной местности, но сценарий заражения и повышения уровня заражения пасек и пчелиных семей не может быть исключен при бесконтрольном расширении торговли пчелами. Поскольку человеческий фактор оказывается весьма значимым в распространении болезней пчел, в том числе и филаментовироза, необходимо усиление мер контроля при импорте и других перемещениях насекомых, организованных пчеловодами.


Сельскохозяйственный университет Монголии

Аннотация. Филаментовироз пчел — заболевание, вызываемое ДНК-вирусом. Он известен в европейских странах и США, но до последнего времени не найдена информация о наличии вируса в Азии. Распространенность этого вируса была определена в Монголии с помощью ПЦР-диагностики.

Ключевые слова: филаментовироз, пчелы, Монголия, пасеки, ДНК-вирус.

1. Батуев Ю.М., Карцев В.М., Березин М.В. Проблема сокращения численности семей пчел // Пчеловодство. — 2010. — № 4.
2. Гробов О.Ф., Смирнов А.М., Попов Е.Т. Болезни и вредители медоносных пчел. — М., 1987. 3. Bailey L., Carpenter J.M., Woods R.D. Properties of A Filamentous Virus of the Honey Bee (Apis mellifera) // Virology. — 1981. — 114.
4. Clark T.B. A filamentous virus of the honey bee // J. Invertebr. Pathol. — 1978. — 32.
5. Gauthier L., Cornmann S. et al. The Apis mellifera Filamentous virus Genome // Viruses. — 2015. — V. 7.
6. Hartmann U., Forsgren E., Charriere J.D., Neumann P., Gauthier L. Dynamics of Apis mellifera Filamentous Virus (AmFV) Infections in Honey Bees and Relationships with Other Parasites // Viruses. — 2015. — V. 7.
7. Sitaropoulou N., Neophytou E.P., Thomopoulos G.N. Structure of the Nucleocapsid of A Filamentous Virus of the Honey Bee (Apis mellifera) // J. Invertebr. Pathol. — 1989. — № 53.
8. Topolska G., Krzyżańska K., Hartwig A., Gajda A. The investigation of bee virus infections in Poland // Annals of Warsaw University of Life Sciences-SGGW. Animal Science. — № 46.
9. Varis Al., Ball B.V., Allen M. The incidence of pathogens in honey bee (Apis mellifera L.) colonies in Finland and Great Britain // Apidologie. — 1992. — № 23.

Цэвэгмид Халиунаа, канд. с.-х. наук, e-mail: Этот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра., Р.О.В. 1091, г. Улан-Батор, Монголия.



Kh. Tsevegmid

DNA virus causes filamentous virus of honeybees. The virus is one of common distributed viruses in European countries and in the USA; however, it was not identified in Central Asian countries, in particular Mongolia until later. Prevalence of this virus has been identified in Mongolia with the help of PCR-based diagnostics

Keywords: filamentous virus, honeybee, Mongolia, apiaries, DNA virus.






toolАдрес редакции журнала "Пчеловодство":
125212, г. Москва, Кронштадтский б-р, д. 7а
Kronstadt Boulevard, 7a, Moscow, 125212

telephone +7 (495) 797-89-29

При использовании, копировании, цитировании публикаций портала beejournal.ru обязательна прямая ссылка на страницу используемого материала.


VKFacebookOKTwitterGoogle plus

Сейчас 382 гостей и ни одного зарегистрированного пользователя на сайте
