Борьба с болезнями и вредителями

Вы можете заказать журналы в редакции:

по тел. 8-495-797-89-29;

е-mail: Этот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра.;

в ИНТЕРНЕТ-МАГАЗИНЕ

или оставить ЗАЯВКУ НА САЙТЕ

Подписаться на журнал Пчеловодство

на почте

по каталогу «Газеты. Журналы»

 агентства «РОСПЕЧАТЬ»

индексы: 70739 (полгода), 71729 (на год).

Подписаться для стран
дальнего и ближнего зарубежья
можно на сайте

«МК-ПЕРИОДИКА»

http://www.periodicals.ru

Подписка
Понедельник декабря 11, 2017
Russian English French German Italian
пчелы

УДК 619:616.995.733.4:636

аннотацияПробы (ульевые пчелы) собраны в Монголии в районах наиболее развитого пчеловодства: в западной части страны (Увс аймаг, Тэс сум) — первая группа (первый регион), в северной части (Сэлэнгэ аймаг, Шаамар, Хушаат, Баянгол сум, Дархан-Уул аймаг Шарын гол, Орхон сум) — вторая группа (второй регион), в центральной части страны (Төв аймаг, Батсүмбэр сум, Улаанбаатар, Тэрэлж, Хэнтий аймаг Багануур) — третья группа (третий регион). 

Идентификация вируса была проведена в течение 2013–2014 гг. в лаборатории Института здоровья пчел Университета Берна. В исследованиях использовали 138 проб из 150 семей указанных трех регионов Монголии. Пробы хранили в морозильнике при –80°С. До проведения молекулярной диагностики на наличие в биопробе филаментовируса определяли зараженность пчел клещами варроа по методике, описанной в Bee Book (2013). ДНК из биологических тканей пчел выделяли с использованием набора NucleoSpin® DNA Insect (Machery Nagel, Франция) согласно инструкции производителя. ПЦР проводили с праймерами CAGAGAATTCGGTTTTTGTGAGTG (F) и CATGGTGGCCAAGTCTTGCT (R) [5] в конечном объеме 25 мкл. При процедуре соблюдали следующие условия: начальная денатурация при 94°C в течение 2 минут, за которой следовали 35 циклов: денатурация при 94°C в течение 30 секунд — отжиг — 56°C в течение 30 секунд — полимеризация — 72°C в течение 30 секунд; заключительная полимеризация — 72°C в течение 2 минут. Для визуализации продуктов амплификации проводили электрофорез в 1,5%-ном агарозном геле.

 

 

Таким образом, при анализе полученных результатов установлено, что степень поражения семей пчел филаментовирозом находится в зависимости от локализации пасек. Логично, что пасеки, находящиеся рядом друг с другом, оказались заражены в большей степени. Возможно, это свидетельствует о том, что пчеловоды близко находящихся пасек «обмениваются» вирусами, когда подсиливают свои пчелиные семьи рамками с кормовыми запасами и с расплодом с соседней пасеки или приобретают там целые семьи. Эффекты такого «подсиливания», по всей видимости, проявляются только в границах одной пасеки или одной местности, но сценарий заражения и повышения уровня заражения пасек и пчелиных семей не может быть исключен при бесконтрольном расширении торговли пчелами. Поскольку человеческий фактор оказывается весьма значимым в распространении болезней пчел, в том числе и филаментовироза, необходимо усиление мер контроля при импорте и других перемещениях насекомых, организованных пчеловодами.

Х.ЦЭВЭГМИД

Сельскохозяйственный университет Монголии

Аннотация. Филаментовироз пчел — заболевание, вызываемое ДНК-вирусом. Он известен в европейских странах и США, но до последнего времени не найдена информация о наличии вируса в Азии. Распространенность этого вируса была определена в Монголии с помощью ПЦР-диагностики.

Ключевые слова: филаментовироз, пчелы, Монголия, пасеки, ДНК-вирус.

ЛИТЕРАТУРА
1. Батуев Ю.М., Карцев В.М., Березин М.В. Проблема сокращения численности семей пчел // Пчеловодство. — 2010. — № 4.
2. Гробов О.Ф., Смирнов А.М., Попов Е.Т. Болезни и вредители медоносных пчел. — М., 1987. 3. Bailey L., Carpenter J.M., Woods R.D. Properties of A Filamentous Virus of the Honey Bee (Apis mellifera) // Virology. — 1981. — 114.
4. Clark T.B. A filamentous virus of the honey bee // J. Invertebr. Pathol. — 1978. — 32.
5. Gauthier L., Cornmann S. et al. The Apis mellifera Filamentous virus Genome // Viruses. — 2015. — V. 7.
6. Hartmann U., Forsgren E., Charriere J.D., Neumann P., Gauthier L. Dynamics of Apis mellifera Filamentous Virus (AmFV) Infections in Honey Bees and Relationships with Other Parasites // Viruses. — 2015. — V. 7.
7. Sitaropoulou N., Neophytou E.P., Thomopoulos G.N. Structure of the Nucleocapsid of A Filamentous Virus of the Honey Bee (Apis mellifera) // J. Invertebr. Pathol. — 1989. — № 53.
8. Topolska G., Krzyżańska K., Hartwig A., Gajda A. The investigation of bee virus infections in Poland // Annals of Warsaw University of Life Sciences-SGGW. Animal Science. — № 46.
9. Varis Al., Ball B.V., Allen M. The incidence of pathogens in honey bee (Apis mellifera L.) colonies in Finland and Great Britain // Apidologie. — 1992. — № 23.

СВЕДЕНИЯ ОБ АВТОРЕ:
Цэвэгмид Халиунаа, канд. с.-х. наук, e-mail: Этот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра., Р.О.В. 1091, г. Улан-Батор, Монголия.

 

 

 

FILAMENTOUS VIRUS ON THE APIARIES IN MONGOLIA

Kh. Tsevegmid

DNA virus causes filamentous virus of honeybees. The virus is one of common distributed viruses in European countries and in the USA; however, it was not identified in Central Asian countries, in particular Mongolia until later. Prevalence of this virus has been identified in Mongolia with the help of PCR-based diagnostics

Keywords: filamentous virus, honeybee, Mongolia, apiaries, DNA virus.

 

 

События

Свежее

Популярное

toolАдрес редакции журнала "Пчеловодство":
125212, г. Москва, Кронштадтский б-р, д. 7а
Kronstadt Boulevard, 7a, Moscow, 125212

telephone +7 (495) 797-89-29,
+7 (499) 270-05-59

noteЭтот адрес электронной почты защищён от спам-ботов. У вас должен быть включен JavaScript для просмотра.

При использовании, копировании, цитировании публикаций портала beejournal.ru обязательна прямая ссылка на страницу используемого материала.

ГИПП

VKFacebookOKTwitterGoogle plus

Сейчас 355 гостей и ни одного зарегистрированного пользователя на сайте

Яндекс.Метрика